Query (optional)   in Class  

GrainGenes Sequence Report: BCD1950_WHE04D10.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD1950_WHE04D10.s1
Probe
BCD1950
DNA Homology
MZENAR2268corn_BlastN
[ Show all 440 ]
DNA
gcaatgccgctgtgggggggggggggcgtggggggggggcgttcacttcc
attggttggcgacgatgtcggcgaggtcgacgaccctctgggagtaaccc
cactcgttgtcgnaccatgcaatgaccttgaccatgtcgtctcccatgac
catgctgagcgacgctcgatggtggaggagacgtcggagcacctgaagtc
gacggacacgaggggctcgtcgcagntccgaggatgcccttgagctcgtt
ggcggcggcgtcgcggaaaccctggttcanctcctcggcgctcgtnccga
attcctgcancccgggggatccactaattctaaaannggccgccancggg
gtggancnccancttttgtttcccntttaatganggtaanttcgnacttt
gggtaancaagggcaaaaacngttcc
BLAST
BLAST Search