Query (optional)   in Class  

GrainGenes Sequence Report: BCD2014_WHE05D04.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD2014_WHE05D04.s1
Probe
BCD2014
DNA Homology
TTADPATP1239wheat_BlastN
[ Show all 349 ]
DNA
tattggtgactgctttggacgcaccatcanggaagaaggctttggctcat
tgtggagaggaaatactgccaacgtcatccgttacttcccaactcaggct
ttgaactttgcattcaaggattacttcaagaggatgttcaacttcaagaa
ggacaaggatggttactggaagtggttcggtggcaaccttgcttctggtg
gtgccgctggtgcttcctcgctgttcttcgtgtactcccttgactatgct
aggacaaggctgggccaatgacgcaaaggcatccaagggtggaggtggaa
aggcagttcaatgggccttgttggatgtctaccgcangactctcaagtca
gatgggtantgctggggcttaccgtggattcaacactccgtgttggaatc
atgtctancgtggtcnctacttng
BLAST
BLAST Search