Query (optional)   in Class  

GrainGenes Sequence Report: BCD266_WHE1B0102

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD266_WHE1B0102
Probe
BCD266
DNA Homology
AF019147208corn_BlastN
AF019147123corn_BlastN
RICOZA178rice_BlastN
DNA
gatgaattccataataacaatggcagctccaaactgcgtgggaatgagct
gagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacga
ccgaacccgattttaggattatgtacaggagcatctattataaagaagat
acttgagagcatagctatcgccatgctgcgccttcgatcgtgggatcacc
caggtggatcatttgcagaagttaatcaccatggccgttggctgtaccga
atgccgtgnatgcaatgtttacgcgctgctctccttgcggtcaattgcat
gccagagaaagcacctataggcttggccagggtangcctctgagccttca
tgacatgggctgtccttggccgcgaggaacgttccctgcttggngttgca
gaagggatnttatgaggggcagcagcgtagtgntcatcgcngccngtagc
accctcaatgggcaanagccccaaggggnanactccttgccgnacncgta
aatgcagcaanggcctgntnnaaggcacccntnnaagngtcccagcggga
aacgttggnccggaaaccgggntttggccgggtangggggttccccccnt
nnccncggnaaagaaggctcnaantannccantttccctggagcctttat
ttaaccnccanccgngatgaacaaccttccccanaggatc
BLAST
BLAST Search