Query (optional)   in Class  

GrainGenes Sequence Report: BCD304_WHE1E0062

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD304_WHE1E0062
Probe
BCD304
DNA Homology
CSPAG13250noncereal_BlastN
[ Show all 1005 ]
DNA
cctcggctgtgcataatagcctaggccgagccgatagagctattcaagaa
cgtcgtgacggtcgctgaagcacaaaaaagttcacctagatcttcacgct
cgcggaaaagtgacgatcctgatctctgtgtggacaatgagctaggattc
gccaaagatcgttcgattagcaggttgacagagctcaacagcagagagta
cttggaggacttcgaagcaaaatggcaacagcccctgcacgctctagatg
acggtggcgatgtcgtactagcatgagtggcagggtttcgtgttctaaga
ccgtattatagttttgttataaatattaacccgcccggctcagggaggaa
tgggagaaatgttggttttcctgtcagtggtgcatgtaattcagtgtgcc
gtgatgtaagcacttctgcatgtaaactcgtgccgaatcctgcagcccgg
gggatccactagttctagagcggccgccancgcggtgggagctcccagct
tttggttccccttaagtgaagggttaattttccgagcttgggcgtaatcc
atggnccaaagctgttnccggngtgaaattgttatccgtccacaattcca
caccaacatacgagccggaagccttaangtggnaaagcnngggngcctaa
tggagtgagccaactcncattaattgcggtgcgcncatggccntt
BLAST
BLAST Search