Query (optional)   in Class  

GrainGenes Sequence Report: BCD342_WHE1G0012

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD342_WHE1G0012
Probe
BCD342
DNA Homology
HSAC000367153noncereal_BlastN
[ Show all 95 ]
DNA
gttggtgccgccgagcatcctattaacgacggtagcggcggcaactcctt
ggcctggagaggatgagtcttctcggatctgcagagatgagacggcctgg
gcagccatgaagcccgggcaggcgaccgttgactggtgtaacgttccttg
gtagtaggacgctttgaggtccctcacttctccccaggttggcagcggat
gcgcgttgccccagtcgatccacctccccctggaagcataagcttgattg
gcgcacataagtccgccgggggagtagatatcacccgcgccttgcatgtc
cagcgtgaaatccagaccagccgaggggtcccagtcgttgcatcttctgt
gcttgttcagcaccagatggcgggattcatcggagtcctcacctatgaga
acatgaagagcgactgttcggctatcgaagcgccttcctcgtccagcctt
tccctgctcctctttcttcttctgcttcntcntctccagtcctgagatga
tggcaccagagtttgcgagcgttttctcgagccgtcgcggnttttctnag
ctgttnnggngnccagtcactttcgnggttcncttnccttnttaaaaact
tggtgctgataaccgangntntccatganaaaaatgngaatgntgnaatg
anagnatattangtaanntcttaacagtannaaagtngggnaaccaaatn
gaantttttgg
BLAST
BLAST Search