Query (optional)   in Class  

GrainGenes Sequence Report: BCD351_WHE05B06.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD351_WHE05B06.s1
Probe
BCD351
DNA Homology
LAMCG106noncereal_BlastN
[ Show all 77 ]
DNA
tcctggtcgcggcgtttgatgaagattcttgctcaattgttatcagctat
gcgccgaccagaacaccttgccgaagttgagtatttttgctgtatttgaa
aaatcactcgggcattggcatgaagaaactaaggattgaactttttgact
gtgacaaggttgattcctgttatatcagtagttggcttcgtattgctgtt
acagcaggaattgaagaactcaccctttatctgccagctgtccctgagga
cgaagcatactacagtttcccatgctcgcttttatttaatgggagtgaaa
actcgattcggtatcttgacataggcatctgtgcctttcgtcccacggtt
ggggcttggtcactggagaagcttggacaatcttatatctggagggaagt
gcnggattgctaacaatcagctagagggccttcttacaattgtggctgca
ttggagcattgggactcctga
BLAST
BLAST Search