Query (optional)   in Class  

GrainGenes Sequence Report: BCD611_WHE03H10.r1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD611_WHE03H10.r1
Probe
BCD611
DNA Homology
ATU63815600noncereal_BlastN
[ Show all 593 ]
DNA
caagattggtggcattggaactgtgccagtgggacgtgttgagactggag
tcatcaagccaggcatggttgtcacctttggccctactggcctgaccact
gaggtcaagtctgttgagatgcaccatgagtctctcctggaggcgcttcc
tgctgatctggccagggtggttcatgatgatgacctgggcagtgaagttg
gcagcctccttggcagggtcgtccttggagttggaagcaacatacccacg
cttnagatccttgacagccacnttcttctcgngccganttcgnnatcaag
cttatcgatacccgtcgacctcnaaggggggcccggaacccnaattcggc
ctataagtgantngggattaaaattcacnggcggtcggttttacaannnn
ngtanttgggnaaaancctgnnggntacccnancntaatcgnnntgnagn
gaanannccntanggnaaaangngggnnnagagaanannggnncna
BLAST
BLAST Search