Query (optional)   in Class  

GrainGenes Sequence Report: BCD611_WHE03H10.s1

[ Submit comment/correction ]

Sequence
BCD611_WHE03H10.s1
Probe
BCD611
DNA Homology
ATU63815463noncereal_BlastN
[ Show all 598 ]
DNA
aagaacgtggctgtcaaggatctcaagcgtgggtatgttgcttccaactc
caaggacgaccctgccaaggaggctgccaacttcactgcccaggtcatca
tcnngaaccaccctggccagatcagcaggaagcgcctccaggagagactc
atggtgcatctcaacagacttgacctcagtggtcaggccagtagggccaa
aggtgacaaccatgcctggcttgatgactccagtcttnatctcgtnctnc
tntggccacagttnccaatgnccaccaatcttgctcgtgnccgaaattnc
ctgncagccccggggggatcccactagtttctagagncggnccgcncaac
cgcggttggnagctcccagcttttgttncccctttaagtggag
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.