Query (optional)   in Class  

GrainGenes Sequence Report: BCD762_WHE04A03.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD762_WHE04A03.s1
Probe
BCD762
DNA Homology
AF01348795corn_BlastN
[ Show all 257 ]
DNA
gagacctcaataaggtaaacatccacattacatctagcagcatccatggg
ttcgcaaatcaacaaacatcaggcaaaacttaaaaaagatggttccagga
acatagttctatatccttgcagataactggctatagcaaaacgactcaat
gcctcagaatcaggccttggcagcagcctgagctgggncatccctcttcc
tctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctc
acccaaggcttggtgcccttgccaatggtgaacacgttgcccagacgggt
gggcaaactggtggaccctggggcatcctcaacgtgggatggtctcaaag
gttccctttatgctttctccctggttctggatcacaccaacacgcccatg
ttggcggcccaccagtcancatgacgacgtgccgacgtcaaatttga
BLAST
BLAST Search