Query (optional)   in Class  

GrainGenes Sequence Report: BCD820_WHE1G0042

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD820_WHE1G0042
Probe
BCD820
DNA Homology
ZMHSP704319corn_BlastN
[ Show all 398 ]
DNA
atccattgcgtagacatgacgtagaaacaccaaaagaaaagcaaaacaca
gaaccaagtataagaaaaaggtgcagcagaaacatcatcgaactaatata
ttgcatagacatgacgtgacatcatgacaccataatccactgatgttacc
tcgaatgttccaactcgcacggaataactacgaccacccacacggagcaa
aataccaccgcaaccaagtctcagataacacagacacgatataataataa
ctagcagcaggcttcaccgcctctgccacagaacatcgactgtttagtcg
acctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatc
gtccatgccacctccatgtcggcaccagcaccctggtacatcttggcgat
gatggggtgcacagggcctccagntccttncatntgtcntcaaactcgtc
cgcttcagcaagctggttngtgtccagccactggattggcngcntgntgg
nctcctggatnttnttnntgnngtcggncgggcancttggaggngntttc
ncggnccctgatggtgtgcggcnggtggaagnanantctcangggttttg
ggnccactttgtcttgggnnctnagccnggattgnnattttnggtttgga
acatttttggnttcncctngtgnggtggcntngtatggggangtntntgg
BLAST
BLAST Search