Query (optional)   in Class  

GrainGenes Sequence Report: BCD828_WHE1D0102

[Submit comment/correction]

Sequence
BCD828_WHE1D0102
Probe
BCD828
DNA Homology
OSCHINDPR415rice_BlastN
[ Show all 480 ]
DNA
ccttattcgggaaaaagtggaggggggaaacatccatcagcagggccggg
cctcctgcctctacgtacatatcctggctaacaaacagtaaaaaccacaa
caggttgaccacaaaaaggttaaaattgcacgttgcttgtaaggagggag
tttcttatcaagcattctccttggcaatcttctctgcttggcaatgacct
cctctattcctccaaccatgtagaatgctgctctgaaangtcgtcgtatt
cccaaccagcacaccctggaaacttttgaacaccctccctaaagtcnaca
tatttcccggtgcggctgtgaaaanntccagcnacatggctngtgccgaa
ttcctgcaagccngggggntccctagttctagagcgggcgccaccgnggt
ggagctccagcttttggtnccnttagnggnggtaaatttcgtatttgggg
nantccnnggncatangnggtttccccgnngtgaaatgtaatccggtcac
aattncccnnnaanntnagggncgggagnntaaagtnnaancctggggng
ctannggngngntaaccncattaatgggtnggncnatgccggtttcat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.