Query (optional)   in Class  

GrainGenes Sequence Report: BCD881_WHE1G0061

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD881_WHE1G0061
Probe
BCD881
DNA Homology
HVU40042104barley_BlastN
[ Show all 663 ]
DNA
tttttttttttttaggcaaaccagataacatgcatattaaccaaggtgcg
aacaggttcaaacataccacaggctcttacaacacggttgtaaaccaaca
accacaaagcaaagcaagcattcaaacagataaagccactcgggcagatc
acagggtggcagcagcaccccagggaggcaggcttctagtactcgtcgcc
ctcatcaccgtcctcgccctcgtcgaactcggcgccaacttcctcgtagt
ccttctccagggcagcgagatcctcacgggcctcagaagaactctcccta
cctccatgccctcgccggacgtaccagtggnacaaaggcacgcttggcgt
aacatgaggttcgaacttgtggtcggatggcgggagaagacctcgnacaa
cgctggtgggagtttgggn
BLAST
BLAST Search