Query (optional)   in Class  

GrainGenes Sequence Report: BCD881_WHE1G0062

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD881_WHE1G0062
Probe
BCD881
DNA Homology
AF008120100grass_BlastN
[ Show all 672 ]
DNA
tttttttttttttaggcaaaccagataacatgcatattaaccaaggtgcg
aacaggttcaaacataccacaggctcttacaacacggttgtaaaccaaca
accacaaagcaaagcaagcattcaaacagataaagccactcgggcagatc
acagggtggcagcagcaccccaggaggcaggcttctagtactcgtcgccc
tcatcaccgtcctcgccctcgtcgaactcggcgccaacttcctcgtagtc
cttctccagggcagcgagatcctcacgggcctcagagaactctccctcct
ccatgccctcgccgacgtaccagtggacaaaggcacgcttggcgtacatg
aggtcgaacttgtggtcgatgcgggagaagacctcgacaacgctggtgga
ttggagatcatgcacacggccctctgggacctttggcgaggtcgccgcct
gggacgaagctgggtggntgtagttgataccgcattggaagccattgggg
caccagtcgacggaattggatggtgcgnttggtctgatggggcnctngnc
gaattcctgaagcccgggggatccataattctaagagggcngcaacgngg
tggagctccngnttttgttcctttgtgangggttaattcgnctngggnaa
tcatgggaaangtgtttcngggttnatgt
BLAST
BLAST Search