Query (optional)   in Class  

GrainGenes Sequence Report: BCD929_WHE1G0071

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD929_WHE1G0071
Probe
BCD929
DNA Homology
HUAC002044123noncereal_BlastN
AA514382142noncereal_EST
R32817139noncereal_EST
W21861137noncereal_EST
DNA
cnngggaacttagannncactttggaactaanncggganactatcangag
caacngnacgcactntntntnactcantctnacacgcccgaaaaggggtt
aaattanaaattaaggatttcccatccggttggggttggacatccctttt
aattttggggaaaccggaagnggggacanacanaatcnaaggacaaatta
cnaattanaacnttnaaaggantggattaccatttntggcnttttcggna
ttcttggggttggatnggggtaattccaaaggnatttggttttggaaacc
caagggaganaaattgggacccaaaaaaaccgggaacccttttggggccc
caattaaggganaaatccaatggccccccaaaaggnanaggggccattgg
gattttaaggggcttttccaaaccaagggaccttgggaaattggnacctt
ttccaaccccnatcccaatttnaacccaggnataaaccggggggccaacc
aatggaccggttttggccttggcccagggaagntnccccccaattggttn
ccgggaaaatnttttcccaatacctacctnttnggggccccnaacngggg
ggggnaaaaaaacccatnttnggtnccccccaatagggtgttgtgnttgt
gtgtgtggctggtgtgtgggtnngtggtgggncnaattccccnaaaattt
tggtttnggcctaantttantttnccaangtttcccggcncaaanttttt
nggggggtttcccaaaccccgggggnaanntttccccaagnggggggaan
ggaaaaaggggatntttccccanggtgtggtntgngtgggtggntggaan
gtggnnccccnttgngtgtggtggggctggattggggtgttggtggtggt
gtggtggtgtgggntggnntttgtgng
BLAST
BLAST Search