Query (optional)   in Class  

GrainGenes Sequence Report: BCD929_WHE1G0072

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD929_WHE1G0072
Probe
BCD929
DNA Homology
BLYTHNC513barley_BlastN
[ Show all 78 ]
DNA
cttttatattaagccaaggtaataaatagattcatcgtggtgactcttat
tggaacgagggaaaaaacagaaatacataactaagatgatacatttgctt
cgatctggtgatggtatcaagattgttgaacagaaaatgacaaaacgacc
ttggccatagaaatcatgcccaagaaggcatgattaggcttcaacagact
gaatgacttcaccatcattacagaaacgggcacatgcgttgctgcagagt
cccatgtcgaatttcatctcttggccacgggaaacattgtccatgttgtc
acagacggaagtcctgcatccaattgtgcagtactcagtcgcatttggtt
caccggattcagggagaagattcagcttagggatagtccctaggacatgt
tggggccgcntatgatttacaaccacaagcagttgcgcagaatggtcggg
aaccaccagcgaaacggcaggcgttgtagccagttctgcccgtcgggttc
ttgcagcaatctggcctcctactnggaccggcnccagactaaaccccata
tgnggaccccaataaccaggccctaanaccctggtggtgccaggtggngg
tgggcctaaattncccccgngccaattccngaagccnggggtccactagt
nnaaagnggccgccancgggggnng
BLAST
BLAST Search