Query (optional)   in Class  

GrainGenes Sequence Report: BCD981_WHE1F0091

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD981_WHE1F0091
Probe
BCD981
DNA Homology
ATHSP812225noncereal_BlastN
[ Show all 567 ]
DNA
gagaagaccaccgagaaggaaatttctgacgatgaagacgaggaggagaa
gaaggataccgaggagggcaaggttgaggatgttgatgaggagaaggaag
agaaggaaaagaagaaaaagaagatcaaggaagtctctcatgagtggaac
ttggtcaacaagcagaagcctgatctggttgaggaagccagaggagatca
acaaggaagagtatgnctgctttctacaagagcttgaccaatgactggga
ggagcatttggctgtcaagcacttctctgttgagggtcagcttggagttc
aaggctgtcctgtttgttcccaagagggccccctttcgacctncttcgac
caacaagnaagaaggccaacaacattcaagctgtnatgtgcgccgttgtc
ttcatccatgggactaac
BLAST
BLAST Search