Query (optional)   in Class  

GrainGenes Sequence Report: BE403955

Sequence
BE403955
Contig
Ta.24959.1.S1_at
NSFT03P2_Contig17773
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC297251
NCBI UniGene
Ta.54306
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Aspartic proteinase'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat etiolated seedling root cDNA library
Tissue
Root
Developmental Stage
Five day old etiolated seedling
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE0415_C08_F15ZS Wheat etiolated seedling root cDNA library Triticum aestivum cDNA clone WHE0415_C08_F15, mRNA sequence.
Other Name
WHE0415_C08_F15ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA008E1X
Clone
WHE0415_C08_F15
Probe
[Wcl109ct528cn851]
{SpCl-989}
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Strategene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
ctcgacctgttgctagcagagacacagcccaaaaagactgctcccaggtt
ggtctgtgcacctttgatgggactcgtggtgttagtgctggaattcggag
cgtggttgatgatgagcctgtgaaatcaaatggcctccgtaccgatccca
tgtgcagtgcctgtgagatggctgttgtgtggatgcggagccaacttgca
cagaacaagacccaggatctcatactggattacgttaaccagctgtgcaa
ccgtctcccgagccccatgggagaatcagccgtggactgtgccagcctcg
gatccatgcctgacattgagttcaccattggcggcaagaagtttgcgctg
aaaccagaagagtatattctgaaggttggtgaaggagccgctgcccagtg
catcagtggattcacagccatggaca
BLAST
BLAST Search