Query (optional)   in Class  

GrainGenes Sequence Report: BE405680

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE405680
Contig
Ta.22981.3.S1_a_at
NSFT03P2_Contig1841
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC365771
wEST map position
BE405680
NCBI UniGene
Ta.22981
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_001047855.1 Os02g0703600 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
6AL
6DL
Clone Library
Wheat etiolated seedling root cDNA library
Tissue
Root
Developmental Stage
Five day old etiolated seedling
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE1214_B03_C06ZS Wheat etiolated seedling root cDNA library Triticum aestivum cDNA clone WHE1214_B03_C06, mRNA sequence.
Other Name
WHE1214_B03_C06ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA008E1X
Clone
WHE1214_B03_C06
Probe
CWEM51
CFE94
MAG1448
WHE1214_B03_C06
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Strategene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology
Ta.22981.3.S1_a_at664WHE2AFFY
Ta.22981.3.S1_a_at272WHE2AFFY
Ta.22981.3.S1_a_at519WHE2AFFY
Ta.22981.3.S1_a_at159WHE2AFFY
DNA
gagtaccaagggtacctgattcccagggctggaaagtgcttcccctgttc
cggaacatccaccacaaccccgaccacttcccctcccctgaaaagttcga
tccttcacgattcgaggtggcccccaagcccaacacgttcatgccgttcg
ggaacgggacccactcgtgccccggcaacgagctggccaagctggagatg
ctcgtcctctgccaccacctcgccaccaagtacagatggtccacctccaa
gtccgagagcggcgtccagttcggccccttcgccctccccatcaacggcc
tccccatgaccttcacccgcaaggacgacaagaacaaagcctgagccatc
catccatccatccatccatcgcctcctcctcgttcccaaagggaaatcaa
cagcgcgatagaggcgacggcgtggcacatgcgagcgagctggatcggct
ccgtccgtgtccgtgccggtcgccgtcggaggggacacttgtagccgtgg
gcgccgcggcgggagcgggagcgggctggcggaggccgatcggagagagc
acgggccgtcaaagtcctttgtacagattcttcag
BLAST
BLAST Search