Query (optional)   in Class  

GrainGenes Sequence Report: BE425171

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE425171
Contig
NSFT03P2_Contig16509
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC292629
NCBI UniGene
Ta.54334
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Fasciclin-like protein FLA15'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat unstressed seedling shoot cDNA library
Tissue
Etiolated shoot
Developmental Stage
Five day old seedling
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE0305_A01_A01ZS Wheat unstressed seedling shoot cDNA library Triticum aestivum cDNA clone WHE0305_A01_A01, mRNA sequence.
Other Name
WHE0305_A01_A01ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA006E1X
Clone
WHE0305_A01_A01
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Shoots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Shoots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
agcaccaacccattgcccgccggcacaccaccacggcaatggcgtcggcg
tcgcggatcctgctcgtggccgcgctgctcctggcggcgtcggcgatgac
gttggcgcagaaggcgaaggcgcccgcgaagccggcccccgccgccgccg
acgcgcccgcggccgtcgaggcgcccgcgaagcccgccccggccgcagcc
gacgcgcccggcgcg
BLAST
BLAST Search