Query (optional)   in Class  

GrainGenes Sequence Report: BE425936

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE425936
Contig
NSFT03P2_Contig5228
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC326851
NCBI UniGene
Ta.9293
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, moderately similar to NP_001058493.1 Os06g0702700 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat unstressed seedling shoot cDNA library
Tissue
Etiolated shoot
Developmental Stage
Five day old seedling
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE0326_F12_K24ZS Wheat unstressed seedling shoot cDNA library Triticum aestivum cDNA clone WHE0326_F12_K24, mRNA sequence.
Other Name
WHE0326_F12_K24ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA006E1X
Clone
WHE0326_F12_K24
Probe
CWEM56
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Shoots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Shoots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology
Ta.9293.1.S1_at555WHE2AFFY
Ta.9293.1.S1_at96WHE2AFFY
Ta.9293.1.S1_at200WHE2AFFY
DNA
tcggtcgtatccctctgggccacgccaagtgtcagcaacaagcaccgaac
ccctcctcccccacctgctagcccatggcggcgactcctcccgccgccgc
cgccgccgcgggcggggcgcaccacagcgtgttcgtctacgggagcctga
tggcggaggaggtggtcaccgccatcctcaagcgcgtcccggcctcctcc
ccggcgctcctcaccaactaccacaggtttaacgtcaaggatcgtattta
tccagcaatcctacctgttgaaaacaagaaagttgctgggaaggttatga
tgggcatttctgatgcagaactcattgtcttggatgcatttgaggatttt
gagtatgtaaggagaagagttcagatatcactaaccgatacatcagagat
aatgcatgctgacacttatgtatggagtgatgcagaggatccagatctgt
atggtgaatgggattttgaggagtg
BLAST
BLAST Search