Query (optional)   in Class  

GrainGenes Sequence Report: BE429639

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE429639
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC281741
NCBI UniGene
Ta.50503
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Ubiquitin protein'
Keyword
EST
Species
Triticum aestivum
Clone Library
ITEC TAS Wheat cDNA Library
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
TAS002.C04R990609 ITEC TAS Wheat cDNA Library Triticum aestivum cDNA clone TAS002.C04, mRNA sequence.
Clone
TAS002.C04
Probe
MAG1879
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Selvaraj G; Plant Biotechnology Institute, National Research Council of Canada; 110 Gymnasium Place, Saskatoon, SK S7N 0W9 Canada; Tel: 306 975 5577; Fax: 306 975 4839; Email: Gopalan.Selvaraj@nrc.ca; International Triticeae EST Cooperative (ITEC); http:
DNA
ccaagctaatctcgtctccgatcgactcgaggcttgtcgaatcctccttc
cccaccgcctcaagatgcagatctttgtgaagacactgacgggcaagacc
atcacccttgaggtggagtcgtctgacaccatcgacaatgtcaaggccaa
gatccaggacaaggagggcattccccctgaccagcagcgtctcatctttg
ctggcaagcagctggaggatggccgaaccctcgctgactacaacatccag
aaggagtccaccctccaccttgtcctgcgtctgcgtggtggcatgcagat
cttcgtgaagaccctcaccggcaagaccatcactctggaggttgagagct
ctgacaccatcgacaatgtcaaggccaagatccaggacaaggagggcatt
cccccggaccagcagcgcctgatctttgncggcaagcagctggaggatgg
ccgcacccttgcggactacaacatccagaaggagtccaccctccacctgg
tgctccgcttcgt
BLAST
BLAST Search