Query (optional)   in Class  

GrainGenes Sequence Report: BE438613

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE438613
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC161102
NCBI UniGene
Hv.7342
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'CDNA clone: FLbaf124p23, mRNA sequence'
Keyword
EST
Species
Hordeum vulgare
Clone Library
ITEC BCD Barley cDNA Library
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
BCD131_WHE01C03R ITEC BCD Barley cDNA Library Hordeum vulgare cDNA clone BCD131_WHE01C03, mRNA sequence.
Other Name
BCD131_WHE01C03R  [ wEST-ACEDB ]  [ wEST-mySQL ]
Clone
BCD131_WHE01C03
Probe
BCD131
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http:
Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http:
Best Peptide Homology
A3469032.50.74
DNA
agggcgtctgcgattcccgatcggagcggttgagcaaaggcggcggcgcc
gcctgcgattcccgatcgaggctcggagcggttgagcaaaggcggcggcg
ctcgagcacggaggactacggagccggcgaatagaagcagcaaggccgtc
tcttccccactcataaaaaatccaaaggtttcttgggattacatattttt
gcaa
BLAST
BLAST Search