Query (optional)   in Class  

GrainGenes Sequence Report: BE438632

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE438632
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC180034
NCBI UniGene
Hv.3233
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Precursor thionin'
Keyword
EST
Species
Hordeum vulgare
Clone Library
ITEC BCD Barley cDNA Library
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
BCD929_WHE01G07R ITEC BCD Barley cDNA Library Hordeum vulgare cDNA clone BCD929_WHE01G07, mRNA sequence.
Other Name
BCD929_WHE01G07R  [ wEST-ACEDB ]  [ wEST-mySQL ]
Clone
BCD929_WHE01G07
Probe
BCD929
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http:
Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http:
Best Peptide Homology
S225151699e-42
DNA
aggagaaattaaggccaaccagccaaccatggcaaccaacaagagtatta
agagcgtggttatttgtgttctcatattgggtttagttctggagcaggtc
caagtagaaggcaagagttgctgcaagaacacgacgggcagaaactgcta
caacgcctgccgtttcgctggtggttcccgaccaatctgcgcaactgctt
gtggttgtaaaatcataagcggcccaacatgtcctagggactatcctaag
ctgaatcttctccctgaatccggtgaaccaaatgcgactgagtactgcac
BLAST
BLAST Search