Query (optional)   in Class  

GrainGenes Sequence Report: BE438633

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE438633
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC181396
NCBI UniGene
Hv.3793
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Transcribed locus, moderately similar to NP_850232.1 RPS14 (MITOCHONDRIAL RIBOSOMAL PROTEIN S14); structural constituent of ribosome [Arabidopsis thaliana]'
Keyword
EST
Species
Hordeum vulgare
Clone Library
ITEC BCD Barley cDNA Library
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
BCD938_WHE01G08R ITEC BCD Barley cDNA Library Hordeum vulgare cDNA clone BCD938_WHE01G08, mRNA sequence.
Other Name
BCD938_WHE01G08R  [ wEST-ACEDB ]  [ wEST-mySQL ]
Clone
BCD938_WHE01G08
Probe
BCD938
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http:
Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http:
Best Peptide Homology
CAB42658.11563e-43
DNA
agtctcagagaagagaaacatgcgtgatcacaaacgtagattgcttgcag
caaaatatgactgagaggaaagctttataagtctgtctgtagggaccctg
atcttccatcagatatgcgggataagtttcgctataagttgtccaagctg
ccaagaaatagtaacatgacacgtcttagaaaccgctgtattttcacggg
acgctctcgtggtgtctaccaaaaattccgcatgtctcgtatcgtgttcc
gtaccttggcaaataagggtgaactgatgggtgttaagaaagcatcttgg
tagatgttaacagatgggtagaagaaagaactagctcttcagtaggccag
caaaataag
BLAST
BLAST Search