Query (optional)   in Class  

GrainGenes Sequence Report: BE438850

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE438850
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC177183
NCBI UniGene
Hv.22598
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'RuBisCO activase'
Keyword
EST
Species
Hordeum vulgare
Clone Library
ITEC BCD Barley cDNA Library
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
BCD1965_WHE2B0062F ITEC BCD Barley cDNA Library Hordeum vulgare cDNA clone BCD1965_WHE2B0062, mRNA sequence.
Other Name
BCD1965_WHE2B0062F  [ wEST-ACEDB ]  [ wEST-mySQL ]
Clone
BCD1965_WHE2B0062
Probe
BCD1965
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http:
Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http:
Best Peptide Homology
T061772731e-72
DNA
gtcattcatcactgatcaccagcacagccgcgcgcatccaccgttgctag
caaggtcgaccaagcagcacagagatggctgctgccttctcctccaccgt
cggggctccggcttctacgccgaccaacttcctcgggaagaagctcaaga
agcaggtgacctcggccgtgaactaccatggcaagagctccaaggccaac
aggttcacagtcatggcagcggagaacatcgacgagaagaggaacaccga
caagtggaagggtcttgcgtacgatatctccgacgaccagcaggacatca
ccagagggaagggcatcgtggactcgctcttccaggcgcccacgggcgac
ggcacccacgaggccgtcctcagctcctacgagtacgtcagccagggcct
gcggaagtacgacttcgacaacaccatgggaggcttctacatcgctcctg
ctttcatggacaagcttgttgtccatctct
BLAST
BLAST Search