Query (optional)   in Class  

GrainGenes Sequence Report: BE438875

[Submit comment/correction]

Sequence
BE438875
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC179280
NCBI UniGene
Hv.3822
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Transcribed locus, strongly similar to NP_001045146.1 Os01g0908700 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Hordeum vulgare
Clone Library
ITEC BCD Barley cDNA Library
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
BCD141_WHE03G11F ITEC BCD Barley cDNA Library Hordeum vulgare cDNA clone BCD141_WHE03G11, mRNA sequence.
Other Name
BCD141_WHE03G11F  [ wEST-mySQL (obsolete) ]
Clone
BCD141_WHE03G11
Probe
BCD141
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http:
Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http:
Best Peptide Homology
AAF54122.130.95.4
DNA
gcaacttccattccgaaacgaaaaccagagataaaataaaataatgccac
ttccccttggaagagatcactgcggatttgtacagacgcatcaatcaaaa
aacaaacatatcccggccgggcgaaacggcggctcacatccatatctaca
cacttgcaagtaccacacacaatttttgctggatccatcagcagcatttt
ctcgttttctcatggcaatggccattcaacacctgcatctgtttcttacg
ctggagtttggatcattcttgcctgggtgtagatactcgaggcgtcccct
gctccatcttcggagcgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.