Query (optional)   in Class  

GrainGenes Sequence Report: BE438997

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE438997
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC180189
NCBI UniGene
Hv.22798
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Cytosolic heat shock protein 90'
Keyword
EST
Species
Hordeum vulgare
Clone Library
ITEC BCD Barley cDNA Library
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
BCD1502_WHE05A11F ITEC BCD Barley cDNA Library Hordeum vulgare cDNA clone BCD1502_WHE05A11, mRNA sequence.
Other Name
BCD1502_WHE05A11F  [ wEST-ACEDB ]  [ wEST-mySQL ]
Clone
BCD1502_WHE05A11
Probe
BCD1502
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http:
Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http:
Best Peptide Homology
HS82_ORYSA1713e-42
DNA
nagggagaactctcccttccttgagaagctgaagaagaagggctatgagg
tcatctacatggttgacgccattgatgagtatgccattggtcagctcaag
gagtttgagggcaagaagcttgtctctgccaccaaggagggtctgaagct
tgatgagagcgaggacgagaagaagaagcaggaggaactcaaggagaagt
tcgaggggctgtgcaaggtcatcaaggaggtgctgggcgacaaggtggag
aaggtcatcgtctctgaccgtgttgtggactcaccgtgctgtctggtgac
tggtgagtatgggtggaccgccaacatggagaggatcatgaaggcccagg
c
BLAST
BLAST Search