Query (optional)   in Class  

GrainGenes Sequence Report: BE438998

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE438998
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC189843
NCBI UniGene
Hv.3823
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'Transcribed locus'
Keyword
EST
Species
Hordeum vulgare
Clone Library
ITEC BCD Barley cDNA Library
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
BCD1670_WHE05A12F ITEC BCD Barley cDNA Library Hordeum vulgare cDNA clone BCD1670_WHE05A12, mRNA sequence.
Other Name
BCD1670_WHE05A12F  [ wEST-ACEDB ]  [ wEST-mySQL ]
Clone
BCD1670_WHE05A12
Probe
BCD1670
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http:
Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http:
Best Peptide Homology
T2992635.20.45
DNA
gagttttttactagctcatagtctcattcatacacacatagcttttcaca
ggctcttggtacagactgtggagagaaacaaaaaaacaggttcatgcctt
catggctacaacaaagctgcagctcttgcgcagcttcaacccaggcaggc
agcaacacccacatgcaagcacgaacccgtcaggccaggcgagctctccc
catgcatctcgatcgccaagagaaacataaactacttactcaatcacatc
tctctcggatcatgccccatctcgatctagtttttcattagtccttgatg
agttcatgttcatggttcatatgcatggccacatatatatatgtatgtag
tactccatggattttgtcaggtgcagttgcagatccggccaagacaagac
atggccggcctacgcatgc
BLAST
BLAST Search