Query (optional)   in Class  

GrainGenes Sequence Report: BE439135

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE439135
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Avena sativa (oat)
Keyword
EST
Species
Avena sativa
Clone Library
ITEC CDO Oat cDNA Library
Tissue
leaf
Data Source
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
Title
CDO465_WHE2G0092F ITEC CDO Oat cDNA Library Avena sativa cDNA clone CDO465_WHE2G0092, mRNA sequence.
Other Name
CDO465_WHE2G0092F  [ wEST-ACEDB ]  [ wEST-mySQL ]
Clone
CDO465_WHE2G0092
Probe
CDO465
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http:
Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http:
Best Peptide Homology
T0441497.93e-20
DNA Homology
T04414
DNA
tttttttttttttttttttatcgcaaaacctcaagaatgcatctctttta
ttgctaaaaaatccaccacaaactcatgtataggtatctcatctttcaat
cccaaccggaaaacttctcccatcttaattatctctcactgcattcattt
cttcgcctcggtggtgagcccgaacccgaacgggaacagcgggtcgtagt
gcttgtcgcccacgttcatcggcagctggtccaccgactttaaccatgtc
ctcgccagcttcccggagaacccatagtcgccga
BLAST
BLAST Search