Query (optional)   in Class  

GrainGenes Sequence Report: BE439364

[Submit comment/correction]

Sequence
BE439364
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Avena sativa (oat)
Keyword
EST
Species
Avena sativa
Clone Library
ITEC CDO Oat cDNA Library
Tissue
leaf
Data Source
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
Title
CDO1312_WHE05E12R ITEC CDO Oat cDNA Library Avena sativa cDNA clone CDO1312_WHE05E12, mRNA sequence.
Other Name
CDO1312_WHE05E12R  [ wEST-mySQL (obsolete) ]
Clone
CDO1312_WHE05E12
Probe
CDO1312
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: Sorrells M; Dept. of Plant Breeding & Biometry, Cornell University; Ithaca, NY 14853, USA; Tel: 607 255 1665; Fax: 607 255 6683; Email: mes12@cornell.edu; International Triticeae EST Cooperative (ITEC); http:
Note: Vector: pBluescriptSK(-); This probe has been used for mapping studies for species of the Triticeae and is available from the GrainGenes Probe Repository ( http:
Best Peptide Homology
AF339147_11404e-33
DNA
aggttcttgctgacaaaggttatgatggtatggctgctgatgtgtggtct
tgcggcataatcttatttgtcctcatggctgggtatttaccctttgatga
ccccaacttaatgactctgtataaaatgatcaccagggctaatgtttctt
gtccaccatggttttctaccggtgcgagaaaacttattaagcgcattatt
gatccgaatccccggaccaggataacaattgcagaaattttg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.