Query (optional)   in Class  

GrainGenes Sequence Report: BE446628

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE446628
Contig
Ta.2583.1.S1_x_at
NSFT03P2_Contig15001
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC286004
wEST map position
BE446628
NCBI UniGene
Ta.2583
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_001042973.1 Os01g0348600 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
3BS
3DS
Clone Library
Wheat etiolated seedling root normalized cDNA library
Tissue
Root
Developmental Stage
Five day old etiolated seedling
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE1458_B09_D18ZS Wheat etiolated seedling root normalized cDNA library Triticum aestivum cDNA clone WHE1458_B09_D18, mRNA sequence.
Other Name
WHE1458_B09_D18ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli DH10B
DNA Library
TA008E3N
Clone
WHE1458_B09_D18
Probe
WHE1458_B09_D18
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before normalization was carried out. The mass excision of phagemid library and normalization were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Normalization protocol used was that of Soares. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology
Ta.2583.1.S1_x_at882WHE2AFFY
[ Show all 11 ]
DNA
tggttgggaattgtactggttttgccgtcaacaggatgttctttccttac
acccagtcagcactcctgtttgttgattatggtatggatgtttacaagat
cgatcgtgcatgtaccaaatttggaatgcccatgggtccattcaggcttg
cagatcttgttggttttggtgttgctgtggctactggtatgcagtacctt
gaaaatttcccggagagagtctacaagtccatgttaatccctattatgat
ggaggacaaaagagcaggcgaagccagtcggaagggattttacaagtacg
aggataggaggaaggcaactcctgatcctgaaattatgacgtatattcag
aaatctaggagcatggcaggagttactcccgacgctgagttgatgaagct
aagtgacaaggacatagtcgagatggtgttcttcccggtcataaacgaag
catgccgtgtccttgatgagggcattgcggtcaaggcgtcggatcttgat
atcgcctcaatc
BLAST
BLAST Search