Query (optional)   in Class  

GrainGenes Sequence Report: BE446683

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE446683
Contig
Ta.28749.1.S1_a_at
Ta.28749.3.S1_a_at
NSFT03P2_Contig17388
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC278997
NCBI UniGene
Ta.55771
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_181989.1 RAB6; GTP binding [Arabidopsis thaliana]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat etiolated seedling root normalized cDNA library
Tissue
Root
Developmental Stage
Five day old etiolated seedling
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE1139_E06_J11ZS Wheat etiolated seedling root normalized cDNA library Triticum aestivum cDNA clone WHE1139_E06_J11, mRNA sequence.
Other Name
WHE1139_E06_J11ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli DH10B
DNA Library
TA008E3N
Clone
WHE1139_E06_J11
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before normalization was carried out. The mass excision of phagemid library and normalization were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Normalization protocol used was that of Soares. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
tcggctctggccaagtacaagctggtcttcctcggcgaccagtccgtcgg
caagaccagcatcatcacccgcttcatgtacgacaagtttgacaacacct
accaggctacgattggtattgatttcctgtcgaagacaatgtaccttgaa
gatagaactgtgagactccaactctgggatacagctggtcaggaaagatt
caggagtttaattccaagctacatcagagactcttcagttgctgttattg
tatttgatgttgcaagcaggcaatctttcttaaacacgtcgaagtggata
gaggaagttcgcactgagaggggcagtgatgtcattatcgtgcttgttgg
gaacaaaactgaccttgtggacaagaggcaagtatccattgaggaagggg
aaggcaaggcaaaggacctcggtgtgatgtttattgaaaccagtgctaaa
gctggttttaacattaaggccctgttccgc
BLAST
BLAST Search