Query (optional)   in Class  

GrainGenes Sequence Report: BE455654

Sequence
BE455654
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
NCBI UniGene
Hv.9842
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'CDNA clone: FLbaf98k19, mRNA sequence'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
Morex
Clone Library
Hordeum vulgare pre-anthesis spike EST library HVcDNA0008 (white to yellow anther)
Tissue
pre-anthesis spike
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
HVSMEg0018J22f Hordeum vulgare pre-anthesis spike EST library HVcDNA0008 (white to yellow anther) Hordeum vulgare subsp. vulgare cDNA clone HVSMEg0018J22f, mRNA sequence.
Strain
lab_host SOLR
vulgare
Clone
HVSMEg0018J22f
Probe
[BE455654.2]
{SpCl-898}
BE455654
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: On Jul 26, 2000 this sequence version replaced gi:9465542.; Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 363; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 568.
Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spike with awns trimmed were collected at white, green and yellow anther stages (Fenton). Total RNA was prepared from each pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close lab (Choi) at the University of California, Riverside. Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing) Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch , Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:
Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spike with awns trimmed were collected at white, green and yellow anther stages (Fenton). Total RNA was prepared from each pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close lab (Choi) at the University of California, Riverside. Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing) Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:
DNA
gtcacacgaactctctcacgtcacacacgcctcctcctcctcctcctcct
cctgcgagccagcccagccactgggagcgcccgcggaagcacagagcggg
aggagggatcgcgagatggactgcaaggatgtcgggatcctcgccatgga
catgtacttccctcccacctgcgtccagcaggaagcgctggaggttcatg
acggggccagcaaggggaagtacacaattggtcttgggcaagactgcatg
gccttctgcagcgaggtagaagatgtcatctcgatgagtttgacagttgt
caaatccctgctggaaaagtaccacatagatccaaagctaattggccgcc
tggaggtcggtagcgagacagtgatagacaaaagtaaatccatcaaaacg
tggctgatgcaaatttttgaggaaagtggtaatactgacattgagggagt
tgactcgagtaacgcatgttatggtgggacagctgccctgttgaactgtg
tgaattgggtcgaaagtcgatgctgggatggacgctacggccttgtggtc
tgcacagatagcgcggtttatgcagagggaccagctt
BLAST
BLAST Search