Query (optional)   in Class  

GrainGenes Sequence Report: BE493751

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE493751
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Secale cereale (rye)
Keyword
EST
Germplasm
Blanco
Species
Secale cereale
Cultivar
Blanco
Clone Library
Secale cereale anther cDNA library
Tissue
Anther
Developmental Stage
Adult plant before anthesis
Data Source
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
WHE1275_H12_O23ZS Secale cereale anther cDNA library Secale cereale cDNA clone WHE1275_H12_O23, mRNA sequence.
Other Name
WHE1275_H12_O23ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
SC024E1X
Clone
WHE1275_H12_O23
Remark
DB_xref: taxon:4550
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Anthers were harvested and pooled from early meiosis to late meiosis. The tissue, total RNA, and poly(A) RNA were prepared (Butler, Ross and Gustafson) at University of Missouri, Columbia. A cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
cggcacgaggctgctccctcccctctcgctggatcaccacaacattctct
ctccctccctggatcctcccccttccctcggctcccacactcccgcaccc
cccttttactcaactgctccactccccactccccaccgccgcggccaacc
gcccccggccccacgccgacgcggcgctggtttccgggaagcagcagcag
cagcaacagcggcggcgaaggaagcgccggagcatggcttgctgatccct
tctctgttgctcgagcggagtggcttggagccggcgccggacatggggcg
gcattgggccggcgtcctgctcctcgccctgcactgcggtgtggcggcgc
tgctccccccctgctccgcggctccggccttgccccctcccatcggcggc
gacgtgtcggcgctgctggcgttcaagcgggcggtgatcgaggacccgca
cgcggcgctggccgactggacggacgccgacggggacgcctgcgactggc
gcggcgtcatctgctcctcgccccacggctccgtcgtctccctgaggctg
tcgaacgcgtcgctcaaggggttcatcgcgccggagctcgggcagctcat
cttcttgca
BLAST
BLAST Search