Query (optional)   in Class  

GrainGenes Sequence Report: BE515381

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE515381
Contig
Ta.247.1.S1_at
NSFT03P2_Contig18659
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC324628
NCBI UniGene
Ta.54370
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Sec61p'
Keyword
EST
Germplasm
BREVOR
Species
Triticum aestivum
Cultivar
Brevor (soft, white, winter, common wheat)
Clone Library
Wheat ABA-treated embryo cDNA library
Tissue
Seed embryo
Developmental Stage
Mature dormant seeds
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE0605_F12_K23ZA Wheat ABA-treated embryo cDNA library Triticum aestivum cDNA clone WHE0605_F12_K23, mRNA sequence.
Other Name
WHE0605_F12_K23ZA  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli DH12S
DNA Library
TA012XXX
Clone
WHE0605_F12_K23
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Clontech Matchmaker 3' AD primer.
Note: Vector: pGAD10; Site_1: EcoRI; Site_2: XhoI; Embryos were cut from mature, dormant seeds and imbibed in 25 microM ABA (abscisic acid) in 5 mM Mes buffer, pH 5.7, for 12 hr at 22 C. The tissue, total RNA, and poly(A) RNA were prepared by Steven Verhey in M.K. Walker-Simmons's lab (USDA-ARS, Washington State Univ., Pullman, Washington 99164-6420. A cDNA library was made by Clontech using a combination of random and oligo dT primers. Library was plated and archived by Russell Johnson (Colby College, ME/Walker-Simmons' lab). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
cgaattcgcggccgcgtcgactttctttgctggcatcattgtcatctgtc
tagatgaacttctccagaaaggctatggtttgggttctggcatttctctc
ttcattgctaccaatatctgtgagaatatcatttggaaggcattcagccc
taccaccatcaacagtggacgtggtgctgaatttgaaggggctgtcattg
cattgttccatctgttgattactcgatcagacaaagtccgtgccctacga
gaagctttctaccgtcagaatctgccaaatgtgaccaatttgcttgctac
tgtcctggtctttctcatagttatctatttccaaggcttccgcgttgtgc
ttccagtgaggtcaaagaatgctcgtgggcagcaaggttcatacccaatt
aagctgttctacacttccaacatgcccatcattctgcactctgcccttat
taccaacctgtatttcatatcccagcttctctacaggaagtacagtggaa
actttctggttaaccttctcggtatatggaaagaatctgaatattctggc
cattctatcc
BLAST
BLAST Search