Query (optional)   in Class  

GrainGenes Sequence Report: BE516164

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE516164
Contig
Ta.18775.1.S1_at
NSFT03P2_Contig13413
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC279185
NCBI UniGene
Ta.54560
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Upregulated following infection by Puccinia (rust) species'
Keyword
EST
Germplasm
BREVOR
Species
Triticum aestivum
Cultivar
Brevor (soft, white, winter, common wheat)
Clone Library
Wheat ABA-treated embryo cDNA library
Tissue
Seed embryo
Developmental Stage
Mature dormant seeds
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE612_G10_N20ZA Wheat ABA-treated embryo cDNA library Triticum aestivum cDNA clone WHE612_G10_N20, mRNA sequence.
Other Name
WHE612_G10_N20ZA  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli DH12S
DNA Library
TA012XXX
Clone
WHE612_G10_N20
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Clontech Matchmaker 3' AD primer.
Note: Vector: pGAD10; Site_1: EcoRI; Site_2: XhoI; Embryos were cut from mature, dormant seeds and imbibed in 25 microM ABA (abscisic acid) in 5 mM Mes buffer, pH 5.7, for 12 hr at 22 C. The tissue, total RNA, and poly(A) RNA were prepared by Steven Verhey in M.K. Walker-Simmons's lab (USDA-ARS, Washington State Univ., Pullman, Washington 99164-6420. A cDNA library was made by Clontech using a combination of random and oligo dT primers. Library was plated and archived by Russell Johnson (Colby College, ME/Walker-Simmons' lab). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
cgcggccgcgtcgacaataaaccagtcctcaaagttgacagcaaagttag
cattgtgatggaacaaatgatcaggttgcttcacgagtgtgggttacctg
cagaggacgtggacttcataaattctgatggtatcacaatgaacaagctg
ctgttggaggcaaatccaaaaatgaccctcttcactgggagctcacgtgt
ggcagagaaattggctgctgatttgcaaggccgaatcaagttagaagatg
ctggttttgattggaaaattcttggtccagatgttcaagaggttgattat
atttcatgggtttgcgaccaggatgcttacgcttgcagcggtcagaagtg
ctctgctcagtctatgctattcatgcacaagaactggtcatctagtgggc
tacttgagaaaatgaagaaactttctgaaagaaggaagcttgaagatttg
acgattggcccagtccttactgttacaacagcaaccatgatagagcacat
gaacaaccttctcaaaataccaggatcaaaggttctgtttggtggtgaac
ctttggagaatcactccatcccagaaatatatggtgctttcaaaccgact
gctgtatttgtcccactagtggagatacttaaaaatggtaacttcgagct
tgtg
BLAST
BLAST Search