Query (optional)   in Class  

GrainGenes Sequence Report: BE516193

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE516193
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Germplasm
BREVOR
Species
Triticum aestivum
Other Name
WHE0608_C01_F02ZA  [ wEST-ACEDB ]  [ wEST-mySQL ]
DNA Library
TA012XXX
DNA
tcgcggccgcgtcgacgccagtagtcatatgcttgtctcaaagattaagc
catgcatgtgcaagtatgaaccaatttgaactgtgaaactgcgaatggct
cattaaatcagttatagtttgtttgatggtacgtgctactcggataaccg
tagtaattctagagctaatacgtgcaacaaaccccgacttctgggagggg
cgcatttattagataaaaggctgacgcgggctctgctcgctgatccgatg
attcatgataactcgacggatcgcacggccttcgtgccggcgacgcatca
ttcaaatttctgccctatcaactttcgatggtaggataggggcctaccat
ggtggtgacgggtgacggagaattagggtt
BLAST
BLAST Search