Query (optional)   in Class  

GrainGenes Sequence Report: BE591127

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE591127
Contig
Ta.5842.1.S1_at
Ta.5842.2.S1_a_at
NSFT03P2_Contig16187
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC343669
wEST map position
BE591127
NCBI UniGene
Ta.5842
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, moderately similar to NP_001057530.1 Os06g0326700 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
7AS
7BS
7DS
Clone Library
Wheat 20-45 DAP spike cDNA library
Tissue
Spike and seed
Developmental Stage
Adult plant
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE0867_H01_O01ZS Wheat 20-45 DAP spike cDNA library Triticum aestivum cDNA clone WHE0867_H01_O01, mRNA sequence.
Other Name
WHE0867_H01_O01ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA017E1X
Clone
WHE0867_H01_O01
Probe
WHE0867_H01_O01
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 20 DAP and seeds at 30 to 45 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors ).
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 20 DAP and seeds at 30 to 45 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology
Ta.5842.1.S1_at599WHE2AFFY
[ Show all 6 ]
DNA
gctatgcaggctggctgccctttagtccctgttttctgcttcggacagac
aaacttacaggtggtggaggccaggaggcaaattgtttgtgaacattgct
agagcactgaaattcactcctattatcttctggggaagatacgggacacc
gatcgctttctcggcacctatgcatgtggttgttggtagacccattgagc
tgaagaaaaatcctctgcctaccattgatgagataaacgaagtgcacgga
caattcgtcggcgccttgcaagaactgtttgagaagtacaagacgaaagc
cggatatcctggcctccatctgagagtcctgtaatactttcttgtggaga
acaagtttcttgtaacatcacggcaattcaccgacgcttgcggc
BLAST
BLAST Search