Query (optional)   in Class  

GrainGenes Sequence Report: BE606573

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BE606573
Contig
Ta.7200.1.S1_at
NSFT03P2_Contig10183
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC295367
wEST map position
BE606573
NCBI UniGene
Ta.7200
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_001062410.1 Os08g0544900 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
5DL
7BL
Clone Library
Wheat 5-15 DAP spike cDNA library
Tissue
Spike
Developmental Stage
Adult plant
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE0903_E01_J01ZS Wheat 5-15 DAP spike cDNA library Triticum aestivum cDNA clone WHE0903_E01_J01, mRNA sequence.
Other Name
WHE0903_E01_J01ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA018E1X
Clone
WHE0903_E01_J01
Probe
[Wcl492ct1270cn1780]
{SpCl-898}
WHE0903_E01_J01
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 5, 10 and 15 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors ).
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 5, 10 and 15 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology
Ta.7200.1.S1_at1195WHE2AFFY
TaAffx.82119.1.S1_at622WHE2AFFY
Ta.7200.2.S1_at567WHE2AFFY
Ta.7200.2.S1_at167WHE2AFFY
TaAffx.106107.1.S1_at58WHE2AFFY
DNA
actctctcacgtcacacacgcctcctcctgcgagccagccactgggagag
cccgcggaagcacagagcgggaggagggatcgcgagatggagtgcaagga
tgtcgggatcctcgccatggacatgtatttccctcccacctgcgtccagc
aggaagcgctggaggttcatgacggagccagcaaggggaagtacacaatt
ggtcttgggcaagattgtatggccttctgcagcgaggtagaagatgtcat
ctcgatgagcttgacagttgtcaaatccctgctggaaaagtaccacatag
atccgaagctaattggccgcctggaggttggtagcgaaacagtgatagac
aaaagtaaatccatcaaaacgtggctgatgcaaaattttgaggaaagtgg
taatactgacattgagggagttgactcaagtaacgcatgttatggtggga
cagctgccctgttgaattgtgtgaattgggtcgaaagtcgatgctgggat
ggacgctacggccttgtggtctgcacagatagcgcggtttacgcagaggg
accagctcggcctacgggaggagctgctgcaattgctatgcttattggtc
caaatgcacctatttcttttgaaagtaaatatagagcttctcacatggct
catg
BLAST
BLAST Search