Query (optional)   in Class  

GrainGenes Sequence Report: BF065801

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BF065801
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
NCBI UniGene
Hv.2972
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'CDNA clone: FLbaf70o15, mRNA sequence'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
CI16151 (Mla6)
Clone Library
Hordeum vulgare seedling green leaf EST library HVcDNA0005 (Blumeria challenged)
Tissue
seedling green leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
HV_CEb0014A14f Hordeum vulgare seedling green leaf EST library HVcDNA0005 (Blumeria challenged) Hordeum vulgare subsp. vulgare cDNA clone HV_CEb0014A14f, mRNA sequence.
Strain
lab_host SOLR
vulgare
Clone
HV_CEb0014A14f
Probe
[Bcl489ct930cn3711]
{SpCl-468}
BF065801
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: On Oct 17, 2000 this sequence version replaced gi:10842440.; Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 526; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 734.
Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; C.I. 16151 (Mla6) plants were greenhouse grown in the R Wise lab at Iowa State University, Ames, IA; 7 day old green seedlings were challenged with isolate 5874 (AvrMla6 ) of Blumeria graminis f. sp. hordei, and leaves were harvested 20 and 24 hr post-inoculation and snap frozen; uninoculated leaves were harvested 20 hr post-inoculation (Wei, Wise). In the TJ Close lab at the University of California, Riverside, total RNA was prepared from each sample pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids (Choi, Close). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum , Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates , Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:
Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; C.I. 16151 (Mla6) plants were greenhouse grown in the R Wise lab at Iowa State University, Ames, IA; 7 day old green seedlings were challenged with isolate 5874 (AvrMla6) of Blumeria graminis f. sp. hordei, and leaves were harvested 20 and 24 hr post-inoculation and snap frozen; uninoculated leaves were harvested 20 hr post-inoculation (Wei, Wise). In the TJ Close lab at the University of California, Riverside, total RNA was prepared from each sample pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids (Choi, Close). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:
DNA
ccaaggaggaaggaaggaaggagaaaccctaaccctagcaatagcaatgg
atccgtccaagctgggcgagctgcggtccttcgtcgacgcctgcaaaaag
gacccctccatcctcgccgaccccgccctcgccttcttccgcgactacct
cgcctccctcggcgcacaactccccgccgccgccgccggagccaagcaca
agcccgcgcccaaggccacctccatggacgacatcgacgacgacgacgag
gaggaggaggaggacgaccaggacatgcgcgaccccacccccgagcccga
cgagctcgacgaggacatcgtcgagtccgacctcgacctcgacgacgacg
gcgtcgtacagcccgaccacgacgacgcgccccaaaagatgggtgactct
tctgttgaggtgaccgaggagaaccgtgacgcctcccaggaagcaaaggg
ccaggcaatggaagcaatgtcagaagggaaactggaagaggccgtcgagc
atctcaccaaggctatactgctgaatccaacctcggcaatcatgtatggt
accagagcatctgtgtttatcaaaatgaagaagcctgctgctgccatccg
tgatgcgaatgctgctctagagatcaacccagactctgcanagggctaca
agacccgtggaaatggctatgccatgcttggcaagtgggaggaagctgct
cgtgatctgcatgccgggtcaaacattgactatgatgatgagaccaatgc
tgccctcaagaagggtggagcctattgcacacaagatagtggagcatccc
aggaagtttgataggctgaggaaagagagggangagaanaaagctgaacg
tgacggctttccccgcgtgcccaggggcaggctgtttttgataggggcca
gaggaaggaggaatcttcaagccc
BLAST
BLAST Search