Query (optional)   in Class  

GrainGenes Sequence Report: BF429122

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BF429122
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
wEST map position
BF429122
NCBI UniGene
Ta.27681
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, moderately similar to NP_001054687.1 Os05g0155000 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
1BS
1DS
Clone Library
Wheat heat stressed spike cDNA library
Tissue
Whole spike
Developmental Stage
Spikes at 5, 10, 15 and 20 days after anthesis
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE1705-1708_I09_I09ZS Wheat heat stressed spike cDNA library Triticum aestivum cDNA clone WHE1705-1708_I09_I09, mRNA sequence.
Other Name
WHE1705-1708_I09_I09ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA032E1X
Clone
WHE1705-1708_I09_I09
Probe
WHE1705-1708_I09_I09
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Spikes at 5, 10, 15 and 20 days after anthesis were heat stressed under two conditions at Texas Tech University (D. Zhang in HT Nguyrn lab): (1) at 38 C for 4 hours and (2) 5 days of cyclic treatment of 38 C for 4 hours. Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton, Malatrasi) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology
Ta.2583.1.S1_x_at119WHE2AFFY
DNA
aaaaaacactgtgcctgttccagataaaatgtcatgcttttgagttgcat
tgtttgaagccatgagagtatgagatatgcatgttgtgggcagaattgta
cccacttacctgtagctatattataatgtagaatgccagccttatatcaa
ttgcagcaggttcctgggatcacagacttaggtttgatgccaagggaagg
tgtctaacgttgccattgttggtggtggacttatgggttctggaatcgca
accgcgctgatactgagccattatcctgttatactgaaagaagtcaacga
ggaattcctaaacgcaggaattgacaggatcaaagaaaacttgcagagtc
gtgtaaggaaaggaaaaatgacaaaggagaaatatgacaagaccctctca
cttcttacaggtgtcctcgattatgaaaaattc
BLAST
BLAST Search