Query (optional)   in Class  

GrainGenes Sequence Report: BF485340

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BF485340
Contig
NSFT03P2_Contig12904
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC348919
NCBI UniGene
Ta.31728
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, moderately similar to NP_566536.1 L-asparaginase, putative / L-asparagine amidohydrolase, putative [Arabidopsis thaliana]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat pre-anthesis spike cDNA library
Tissue
Spike before anthesis
Developmental Stage
Adult plant
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE2310_C12_E24ZS Wheat pre-anthesis spike cDNA library Triticum aestivum cDNA clone WHE2310_C12_E24, mRNA sequence.
Other Name
WHE2310_C12_E24ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA019E1X
Clone
WHE2310_C12_E24
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Whole spike with awns trimmed, white, green and yellow anther were collected and total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
caagtgccttcagtcacatagcaacacaccacccccagcacacatacata
agcacgcatggcgcgctggggcattgccatccacggcggcgcgggcgtgg
accccaacctgccggagcaccgccaggaggaggccaagcgcgtgctggcc
cggtgcctgcaggtgggtgtggacctgctgcggtccggcgccgccgcgct
ggacgtcgtggaggccgtggtgcgcgagctggagacggacccctgcttca
actcgggccgcggctccgcgctcacccgcgccggcaccgtcgagatggag
gccagcatcatggacggccgcggccgccgctgcggcgccgtctctggggt
gtcgacggtccggaacccggtctccctggcccgccgcgtcatggaca
BLAST
BLAST Search