Query (optional)   in Class  

GrainGenes Sequence Report: BG274948

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BG274948
Contig
Ta.5935.1.S1_at
NSFT03P2_Contig18083
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC293573
wEST map position
BG274948
NCBI UniGene
Ta.54398
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_178124.1 SUS2 (ABNORMAL SUSPENSOR 2) [Arabidopsis thaliana]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
5AL
[ Show all 6 ]
Clone Library
Wheat salt-stressed crown cDNA library
Tissue
Crown
Developmental Stage
Adult plant
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE2119_C11_F21ZS Wheat salt-stressed crown cDNA library Triticum aestivum cDNA clone WHE2119_C11_F21, mRNA sequence.
Other Name
WHE2119_C11_F21ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA038E1X
Clone
WHE2119_C11_F21
Probe
WHE2119_C11_F21
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA and poly(A) RNA were prepared from crown tissue, equal portions of RNA were pooled from the two treatments, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology
Ta.5935.1.S1_at860WHE2AFFY
Ta.5935.1.S1_at331WHE2AFFY
Ta.5745.1.S1_at593WHE2AFFY
Ta.5745.1.S1_at319WHE2AFFY
Ta.6946.1.A1_at172WHE2AFFY
DNA
tccttgctgacttggagccgttgggatggatgcatacccagccgaatgaa
gctcctcagctatcacctcaggatttgacatcacatgctaaaattttgga
gaacaacaagcagtgggatggtgagaagtgcatcattttgacctgcagct
tcaccccaggatcgtgctcgttgactgcgtacaaattgacaccaagtggt
tatgagtgggcccgtggcaacaaggacaacgggagcaacccacaagggta
cctcccaactcactacgagaaggtccagatgcttctcagcgaccgcttcc
ttggattctacatggttccggacaacgctccgtggaactacaacttcatg
ggagtcaagcacgacccgctgatgaagtacagcatgaagctgggcacacc
ccgcgacttctaccatgaggaccacaggccgacgcacttcctggagttca
gcaacattg
BLAST
BLAST Search