Query (optional)   in Class  

GrainGenes Sequence Report: BG275060

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BG275060
Contig
Ta.9184.1.S1_at
NSFT03P2_Contig16618
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC308619
wEST map position
BG275060
NCBI UniGene
Ta.54359
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_001046536.1 Os02g0274100 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
3AS
3BS
6AS
6BS
Clone Library
Wheat salt-stressed crown cDNA library
Tissue
Crown
Developmental Stage
Adult plant
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE2117_C08_E15ZS Wheat salt-stressed crown cDNA library Triticum aestivum cDNA clone WHE2117_C08_E15, mRNA sequence.
Other Name
WHE2117_C08_E15ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA038E1X
Clone
WHE2117_C08_E15
Probe
WHE2117_C08_E15
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA and poly(A) RNA were prepared from crown tissue, equal portions of RNA were pooled from the two treatments, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology
Ta.9184.1.S1_at876WHE2AFFY
Ta.2583.1.S1_x_at52WHE2AFFY
DNA
gcgtcgcgctcatcaccatctgcaacccgccagtcaatgctctgcacccc
atcatcatccaggggctcaaggagaagtacgcggaggcggctggtcgcga
cgacgtcaaggccatcgtgctcactggtgctgcggggaaattttgtggag
gcttcgatatcaatgtcttcacaaaagttcatgagactggagatgtgtca
cttatgcctgatgtatctgttgatcttgtatcaaacatgatggaagatgg
caaaaagccttctgttgctgcaattcaaggccttgctcttggtggcggtc
taaagttgattatgggttgtcatgctcggatatctacccctgaagctcaa
cttggattaccagagctaactcttggcgtgattcctggatttggaggaac
tcagcgtctaccgaggctcgtaggtctgcccaaagcaatagaaatgatgc
tgcaatcgaag
BLAST
BLAST Search