Query (optional)   in Class  

GrainGenes Sequence Report: BG312657

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BG312657
Contig
Ta.30803.1.S1_at
Ta.30803.1.S1_x_at
NSFT03P2_Contig18637
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum monococcum
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum monococcum
Triticum aestivum
Cultivar
DV92
Clone Library
Triticum monococcum early reproductive apex cDNA library
Tissue
Early reproductive apex
Developmental Stage
Seven week-old plants
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE2456_E01_I02ZS Triticum monococcum early reproductive apex cDNA library Triticum monococcum cDNA clone WHE2456_E01_I02, mRNA sequence.
Other Name
WHE2456_E01_I02ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli XLOLR
DNA Library
TA042E1X
Clone
WHE2456_E01_I02
Remark
DB_xref: taxon:4568
[ Show all 6 ]
DNA
gtggaggtgtatgtccgcgtcacaggcggggaggtcggcgctgcgtcgtc
cctggcccccaagatcggtccgctcggtctctccccaaagaagatcggag
aagacatcgccaatgagacggcctatgactggaagggcctccgcgtcacc
ggcaagctcaccgtccagaatcgccaggccaaggtgtccgtcgtcccctc
cgccgcagccctcgtcatcaaggcgctcaaggagcccgagagggaccgca
agaaggtcaagaacatcaagcacaacggcaacatcagcctcgacgacgtc
atcgagatcgccaagatcatgaaggtccgctccatggccaaggagatggc
cggcaccgtcaaggagatcctcggcacctgcgtc
BLAST
BLAST Search