Query (optional)   in Class  

GrainGenes Sequence Report: BG313123

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BG313123
Tracefile
[ Download ]
[ View ]
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC324787
wEST map position
BG313123
NCBI UniGene
Ta.50502
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, weakly similar to NP_001055028.1 Os05g0250700 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Germplasm
Chinese Spring
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
4AL
4BS
4DS
Clone Library
Wheat salt-stressed sheath cDNA library
Tissue
Sheath
Developmental Stage
Adult plant
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE2054_A03_B06ZS Wheat salt-stressed sheath cDNA library Triticum aestivum cDNA clone WHE2054_A03_B06, mRNA sequence.
Other Name
WHE2054_A03_B06ZS  [ wEST-ACEDB ]  [ wEST-mySQL ]
Strain
lab_host E. coli SOLR
DNA Library
TA037E1X
Clone
WHE2054_A03_B06
Probe
WHE2054_A03_B06
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA was prepared from sheath tissue, equal quantities of RNA were pooled from the two samples, polyA was purified from the pooled RNA, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin , Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA was prepared from sheath tissue, equal quantities of RNA were pooled from the two samples, polyA was purified from the pooled RNA, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
gccctgctgcacccaactcccagatggcttgtgtaggctcccgtatttgg
agtggataatggtggacggggctccagtaatcaagtgtattggtcctgaa
tttgttcaa
BLAST
BLAST Search