Query (optional)   in Class  

GrainGenes Sequence Report: BG604429

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BG604429
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
NCBI UniGene
Ta.25866
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Wheat vernalized crown cDNA library
Tissue
Crown tissue of seedling
Developmental Stage
Five-week old seedling
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE0833_E01_I01ZS Wheat vernalized crown cDNA library Triticum aestivum cDNA clone WHE0833_E01_I01, mRNA sequence.
Strain
lab_host E. coli SOLR
Clone
WHE0833_E01_I01
Probe
BG604429
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were germinated and grown at 4 C for 5 weeks. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
ctgcaaggctgtgacatacttcaaaacttgcctgcaacccttggtcatct
ccaaacacttgagcatcttagggtgtcatgtcgttatgatattggtgagc
tagctgactctctctgcaatcttcatgatcttcggtttattgatttgtgg
aggggcgctgagcttccacagttgccttgttcatttggtaatttagtgag
gggggaggatctaaacctatctagtggcttcaacctcaaccagctaccag
aatcttttggcaacctttattttcttaggtctctgaacatgtcgagctgc
tctgagctcgaacaattgcctggatctttt
BLAST
BLAST Search