Query (optional)   in Class  

GrainGenes Sequence Report: BI751677

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BI751677
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC358182
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
EST
Species
Triticum aestivum
Cultivar
Frontana
Clone Library
Ta01_AAFC_ECORC_Fusarium_graminearum_inoculate d_wheat_heads
Tissue
heads
Developmental Stage
anthesis
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
Ta01_13d04_R Ta01_AAFC_ECORC_Fusarium_graminearum_inoculated_wheat_heads Triticum aestivum cDNA clone Ta01_13d04, mRNA sequence.
Clone
Ta01_13d04
Probe
MAG3094
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Ouellet, Therese; Eastern Cereal and Oilseed Research Centre; Agriculture and Agri-food Canada; Neatby Bldg., Central Experimental Farm, Ottawa, Ontario, K1A 0C6,; CANADA; Tel: (613) 759-1658; Fax: (613) 759-1701; Email: ouellettr@em.agr.ca.
Locus Comment: Contact: Ouellet, Therese; Eastern Cereal and Oilseed Research Centre; Agriculture and Agri-food Canada; Neatby Bldg., Central Experimental Farm, Ottawa, Ontario, K1A 0C6,; CANADA; Tel: (613) 759-1658; Fax: (613) 759-1701; Email: ouellettr@agr.gc.ca.
Note: Vector: pGEM-T easy; Site_1: EcoRI; Site_2: EcoR1; Controled chamber-grown wheat heads were spray inoculated at mid-anthesis with a Fusarium graminearum macroconidial suspension (50,000 spores/ml) and kept under intermitent misting for 24 hours, then collected and immediately frozen in liquid nitrogen.
DNA
acatacaggtcggtgaagaagtttgaagaggtctacttccagagcatcag
ccagcctaaccacgcgcgtccaccgaagacggcgctggactagagctcgt
gaagaaaacgctcgarctgatcgacgctccagtnagggaacctggctgac
tgaatgcctccaacaacgtgactnahgcgccatgcatgthgcatgagaha
aggctgaccagatcagctccacaagaacatctaacctataacgatagtcc
aacatgaatccctttttatctaacttcattgacggcttcatcgtcgcccg
trtcggctttgatccgagccctctgagaggttagcagatgatgcaccctt
tgctttagctcttgcgttccgatttggctctgcaccgacacccggatggc
gtcttccggtccaaactctctgtatctcctcaattcatcgtcgacgccat
catcagcggc
BLAST
BLAST Search