Query (optional)   in Class  

GrainGenes Sequence Report: BJ213180

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BJ213180
Contig
Ta.3571.1.S1_at
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC295881
NCBI UniGene
Ta.3571
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Y. Ogihara unpublished cDNA library, Wh
Tissue
spike at meiosis
Developmental Stage
Feekes' scale 9
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
BJ213180 Y. Ogihara unpublished cDNA library, Wh Triticum aestivum cDNA clone wh21d09 5', mRNA sequence.
Clone
wh21d09
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Tadasu Shin-i; Center For Genetic Resource Information; National Institute of Genetics; 1111 Yata, Mishima, Shizuoka 411-8540, Japan; Tel: 81-559-81-6856; Fax: 81-559-81-6855; Email: tshini@genes.nig.ac.jp.
DNA
gggcgccgccgcgtcactcctcctccttctcaggcgctgcagcttcactc
ctcctcctccccaggcgccgcagcgtcactcctcctcctcctcaggcgcc
gcagcttcactcctcctccccaggcgccgccgcgtcaccgcttcttcgtt
cgccgcgctatctcctcccagtcgcccatggatatcacgcgtggcgccgc
cgcagctttctcgcggggtgccctttttgctgttcgctcccatgcgagga
tcggtttctatgggggtttgttcatggttgtgtcgtcggttgccgggaaa
gtcgtcgtacacagttttccgcaccttggagataggctaatgcggtgctc
caagtactgttcgctcgtcttttcttccataaccacgacatcggtggtag
ccagttccatcatccggtacaccatgcctgaccctgatatcatcttcgta
aaccctcttcctctgccgcctgccaggtttaatgccttggctgatccaga
tccggggttcaagcatgcttttggagagcgtctactctttattgagacac
ttgaccttaacaacataccttggttgatccatccttggattgatgctgat
gctcgtggagatatcatcaatattgatgtgg
BLAST
BLAST Search