Query (optional)   in Class  

GrainGenes Sequence Report: BJ228716

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BJ228716
Contig
Ta.30803.1.S1_at
Ta.30803.1.S1_x_at
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC287036
NCBI UniGene
Ta.54141
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_200875.1 60S ribosomal protein L12 (RPL12C) [Arabidopsis thaliana]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Clone Library
Y. Ogihara unpublished cDNA library, Wh_dL
Tissue
crown of seedling
Developmental Stage
Feekes' scale 1
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
BJ228716 Y. Ogihara unpublished cDNA library, Wh_dL Triticum aestivum cDNA clone whdl7l21 3', mRNA sequence.
Clone
whdl7l21
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Tadasu Shin-i; Center For Genetic Resource Information; National Institute of Genetics; 1111 Yata, Mishima, Shizuoka 411-8540, Japan; Tel: 81-559-81-6856; Fax: 81-559-81-6855; Email: tshini@genes.nig.ac.jp.
DNA
gtaaaaaatagtctcacaatggaaccagtaaagcatgacaaaagtttctt
cttcagcaagagtagaacaagtgaagatatcacatccattctctcaaatg
catcaggaagcatctagataggagaaactacttcagcagcctcacataac
aacctgcccaaagccaagccttcttaagcggggatctccacctcgccgtc
gtcgatctccgtctgcagatccttggggtccttgccgtcaacggtgcagc
cgacgctgacgcaggtgccgaggatctccttgacggtgccggccatctcc
ttggccatggagcggaccttcatgatcttggcgatctcgatgacgtcgtc
gaggctgatgttgccgctgtgcttgatgttcttgaccttcttgcggtccc
tctcgggctccttgagcgccttgatgacgagggctgcggcggaggggacg
acggacaccttggcctggcgattctggacggtgagcttgacggtgacgcg
gaggcccttccagtccttggccgtctccttggcgatgtcttctccgatct
tctttggggagagaccgagcggaccgatcttgggggc
BLAST
BLAST Search